apocope - definition and examples of apocope in English

Apocope is a  rhetorical term for the omission of one or more sounds or syllables from the end of a word. Also called end-cut, apocope is a type of elision. Etymology: From the Greek, to cut off Examples and Observations In many poor neighborhoods, the Sandinista Front has more street cred than the local youth gang.(Tim Rogers, Even Gangsters Need Their Mamas. Time magazine, Aug. 24, 2007)Season your admiration for a while with an attent ear.(William Shakespeare, Hamlet, Act I, scene 2)Loss of sounds from the end of a word is known as apocope, as in the pronunciation of child as chile.(Thomas Pyles and John Algeo, The Origins and Development of the English Language. Harcourt, 1982)After he left the city, thousands of people toasted him with beer at a barbie, an Australian barbecue.(Pope in Australia, The New York Times, Dec. 1, 1986)Newspapers have their own style and it is important that your feature matches it. For instance, it would be pointless writing a feature for a staid weekly in the style of something more suitable for a lads mag.(Susan Pape and Sue Featherstone, Feature Writing: A Practical Introduction. Sage, 2000) New Words and Names Quite a few English words have resulted from apocope, among them cinema (from cinematograph) and photo (from photograph). Names often undergo apocope (e.g., Barb, Ben, Deb, Steph, Theo, Vince).(Bryan Garner, Garners Modern American Usage. Oxford University Press, 2009) Lost Vowels Apocope is a process that deletes word-final segments, including unstressed (reduced) vowels. In Middle English, many words, such as sweet, root, etc. were pronounced with a final [e], but by the time of modern English, these final reduced vowels had been lost. We still see signs of final reduced vowels in the archaic spelling of words like olde.(Mary Louise Edwards and Lawrence D. Shriberg, Phonology: Applications in Communicative Disorders. College-Hill Press, 1983)Oliver Sacks on His Favorite WordOne of my favorite words is apocope--I use it (for example) in A Surgeons Life: . . . the end of the word omitted by a tactful apocope (Anthropologist on Mars, Vintage, p. 94).I love its sound, its explosiveness (as do some of my Tourettic friends--for when it becomes a four-syllable verbal tic, which can be impaired or imploded into a tenth of a second), and the fact that it compresses four vowels and four syllables into a mere seven letters.(Oliver Sacks, quoted by Lewis Burke Frumkes in Favorite Words of Famous People. Marion Street Press, 2011) Pronunciation: eh-PAHK-eh-pee

China Sea And Chinese Foreign Policy - 1218 Words

The general consensus among academics and experts in the field of politics concludes that China is assertive. The assertive conduct of China can have an impact on the regional order and stability in South China Sea. The academics and experts in politics have different perspective on the assertive behaviour of Chinese foreign policy. The argument in favour of implementing assertive foreign policies affirms that China has good intentions regarding the South China Sea. China is required to have an assertive behaviour to bring regional stability and solve the territorial disputes on the South China Sea. The opposing argument on assertive foreign policies displays concerns with the aggressive and provocative behaviour of China (Chen, Pu †¦show more content†¦The maritime claims and sovereign claims of China in the South China Sea through the nine-dash line must comply with the UN Convention on the Law of the Sea (Rapp-Hooper, 2016, 78). â€Å"China had historic rights to the Sou th China Sea through the nine-dash line until it ratified the UNCLOS in 1996† (Rapp-Hooper, 2016, 78). China is bound to follow the international law to defend its sovereign rights despite the tribunal in the Hague ruling in favour of the Philippines (Rapp-Hooper, 2016, 81). The ruling of the tribunal in The Hague was hard on China (Rapp-Hooper, 2016, 78). The ruling has placed limitations to the maritime claims of China in the South China Sea (Rapp-Hooper, 2016, 80). The maritime claims of China to water and airspace was declared invalid under international law (Rapp-Hooper, 2016, 76). China â€Å"cannot legally continue to declare military zones in the water or airspace around the reefs it occupies, nor can it do so more than 12 nautical miles from the rocks it controls† (Rapp-Hooper, 2016, 80). The invalidated the maritime claims of China to the waterways in the South China Sea through the nine-dash line (Rapp-Hopper, 2016, 77-78). China had sought to get entitlement to the South China Sea through Itu Aba (Rapp-Hooper, 2016, 79). The tribunal declared that Itu Aba was not an island like the Spratly Islands and China could not legally claim the entire South China SeaShow MoreRelatedChinese Foreign Policy And Its Effect On The Regional Order And Stability Of South China Sea1338 Words   |  6 Pagesconsensus among scholars concludes that China is assertive (Chen, Pu Johnston, 2014, 176). The assertive conduct of China can have an impact on the regional order and stability in South China Sea. The scholars have different views on the assertiveness of Chinese foreign policy (Chen et al., 2014, 176). The argument in favour of implementing assertive foreign policy affirms that China has good intentions regarding the South China Sea (Chen et al., 2014, 181). China is required to have an assertive conductRead MoreChinas Expansion Into The South China Sea Case Study1351 Words   |  6 PagesAround the year 2015 China has started building artificial islands on disputed territory in the South China Sea for the purpose of resource mining, installment of surveillance and defensive infrastructures. Countries in the South China Sea that lay economic and territorial claims such as the Philippines, Malaysia, and Japan have expressed sec urity concerns regarding China’s aggressive expansion unto territories such as the Spratyl Islands and Rubi Reef as China had increased security and surveillanceRead MoreChina Foreign Policy800 Words   |  4 PagesXi Jinping’s regime, foreign policy is both continuity and changes. The continuity is that China has still concerned on peaceful development by increasing connection with neighbors . But China’s foreign policy has some changes to be more proactive approach, strengthen relationship with ASEAN, achieve common development and build community of common destiny which China aims to achieve as a leadership role through Chinese initiatives such as AIIB and RCEP. Beyond investment, China want to be at leastRead MoreEssay On China Global Power1260 Words   |  6 Pagesheavy-handed foreign policy towards its neighbors. Internal disputes have included a political crisis in Hong Kong over the right to vote, minority oppression in Inner Mongolia, and unhealthy ai r quality. China’s rise has changed the Asian power dynamic. Chinese foreign policy towards North Korea, protective in nature, has drawn criticism. Worried about instability in Korea driving untrained refugees into China, its leadership opposes any transformative actions in the region. China’s policy towards JapanRead MoreAustralian Chinese Relations : Australia s Largest Trading Partner1285 Words   |  6 PagesThe Australian-Chinese relationship stands as an important symbol for international relations in the Asian region. Presently, Australian face an important juncture in their relationship with China. Should Australians be concerned with Chinese military aggressions in the South China Sea or be more focused on strengthening an already strong Australian-Chinese economic partnership? China is Australia’s largest trading partner and has been a vehicle for Australian economic growth in recent decades (DrysdaleRead MoreThe Rise Of Pollution Levels1204 Words   |  5 Pages There I was in Shanghai, China, staring at the sun as if I were trying to look at a lamp behind a curtain. The rise of pollution levels in China has intrigued the minds of people who never even cared about the environment before. The People’s Republic of China is now the largest emitter of CO2 in the world. But of course, this a global phenomenon: a global phenomenon that in no way started with China as Alanna Mitchell would agree to. By the end of the 19th century, the powerful duo that was industrializationRead MoreXi s Consolidation Of Power : Why China May Define Our Future World Order1485 Words   |  6 PagesXi’s Consolidation of Power: Why China May Define our Future World Order On October 27th 2016, the world watched as China officially named its President Xi Jinping the ‘core leader’ of the Chinese Communist Party (CCP) at the Sixth Plenum of the 18th CCP Central Committee. In the new directive released through state media, all party members should â€Å"closely unite around the party center with Comrade Xi Jinping as the core...and unswervingly safeguard the party leadership’s authority and centralizedRead MoreChina s Become A Global Superpower And Its Transformation From A Development Aid Recipients767 Words   |  4 Pages I once regretted that I majored in Chinese Language and Literature. Even after completing my Master s degree in China I could not see the practical use of my studies. However, now I think it has become my strength to comprehend Chinese Language and culture as a student who seeks to research on the International Studies related to China as a Ph.D. candidate. During my study in China, I witnessed China’s emergence as a global superpower and its transformation from a development aid recipient toRead MoreThe Function of the Truman Doctrine and Marshall Plan in Preventing the Spread of Communism During the Cold War952 Words   |  4 PagesThe foreign policy of the United States during the Cold War fully supported the growth of democratic nations. The USSR, however, wanted countries to become communist like them. These opposing views led to tension between the two nations. As a result, in 1947, President Truman issued the Truman Doctrine which stated that the United States would supply aid to any country as long as they pledged to be democratic. The Marshall plan was enacted in 1948 and it was similar to the Truman Doctrine exceptRead MoreChina And China1145 Words   |  5 Pagesclash into war. United States and China have high economic interdependence as the United Kingdom and Germany before WW I. In short, the fact that both stat es could go to war is not out of the question. North Korea has been recently menacing the United States in its pursuit of the nuclear military capability. Although that threat is dangerous, it is not the greatest for the United States. Considering the current strategic environment, the rise of a nationalist China is the greatest threat that the

Challenges of the New Century free essay sample

This paper looks at the future of business in the 21st century, and changes that should occur in organizational structures and management. This paper presents a look at two of the main challenges that are going to face businesses in the 21st century. We will write a custom essay sample on Challenges of the New Century or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page The author takes the reader on a tour of possible challenges and details why they will occur and what might be done about them. The paper discussed the impact that is likely to happen to organizational structure as well as management practices. Business has been around since the beginning of time. As the world has evolved so have the businesses. Each time technology moves us a bit further along on the time line of history we move the ways we do business to accommodate the changes. The technological boom of the last three decades however, has provided us with means that we never dreamed possible. While this is a positive change for many areas of business it is also a challenge as we move into the 21st century. There are two essential challenges that will occur going into the next century and the management practices and organizational. Structure will have to change to accommodate them. The advent of the Internet as well as telecommuting is both relatively new business components. Each of them has advantages as long as business management and organizational structure change with them.

Prometheus Essays - Prometheus, Titans, Greek Mythology, Hera, Io

Prometheus Though long engraved into history, the ancient world of Greece still remains present throughout the cradle of humanity in several ways. Its rich contributions in literature, drama and art have shaped even modern civilizations. Through the characters in the Greek myths, morals and standards that remain to dominate society are presented to us. These figures in mythology appeared as gods, goddesses, heroes, and even mortals, who teach not just through their triumphs but also through their less honorable moments. One of the most noble of these characters, was Prometheus. Prometheus was a Titan (or elder god) who could often see into the future. He first enters mythological tales when he aided Zeus in the struggle to claim the throne of King of the Gods. Several later stories portray Prometheus character as intelligent, philanthropic, and non compliant when faced with injustices. The great hero Hercules was brave and strong, but there was something he lacked. It is carefully noted along with his story that he was weak in the area of intelligence, his major disadvantage. This is a quality Prometheus possessed. Prometheus is labeled throughout mythology as being very wise. In some stories he is called the wisest in the universe. This is a feature not many other figures in mythology possessed. It was due to his wisdom that his family survived the great flood and humans received many of their advantages. Prometheus is depicted as helping humans throughout Greek mythology. In one story, he consoles Io, a young girl punished due to Heras jealousy, during her time of pain and confusion. In this story he directs her to a more promising future. There is also strong emphasis on his assisting the human race as a whole. It was Prometheus who made mankind the superior race. He gave man both the superior protection, fire, and superior form, upright like the gods. Zeus was angered when Prometheus gave man so many advantages, and also because he would not reveal whom the future told would dethrone him. Forgetting the debt he owed Prometheus for all he had helped him with in the past, he decided to torture Prometheus until he revealed the information he knew. Prometheus was bound to the rocky peak on Caucasus, wrapped in unbreakable chains, unable to sleep or relax. Everyday an eagle came down and tore at his flesh. Prometheus knew he had served Zeus well and was right in his assistance to man. He refused to yield to Zeus, and endured the pain. His body was bound but his spirit was free. He now remains a symbol of rebellion against injustice to many. In summary, along with its culture and values, ancient Greece has left us more. It has left us great figures to look up to and admire. It has left us characters such as Prometheus to pave a road of morals and standards for the present as well as future. His qualities of wisdom, altruism, and strong will have been revealed through both his stories of triumphs and pain, stories that never die. These stories will be told for generations to come. Bibliography ff Mythology Essays

How to become a medical receptionist

How to become a medical receptionist Careers in healthcare are booming right now. With significant advances in technology changing the game and an ever-larger population in need of healthcare services, it’s one of the biggest growth industries for the foreseeable future. But what if you’re not as interested in the hands-on medical end of things, or your skills are more administrative in nature? Becoming a medical receptionist could be the right path for you, with the best of both worlds. What does a medical receptionist do?Medical receptionists have many of the same duties as receptionists in other industries, but with a healthcare twist- managing patient records, taking initial medical information when a patient comes in, and managing day-to-day tasks for a medical office. A medical receptionist’s responsibilities may include the following:Answering phones and greeting patients in the officeTaking preliminary patient information, including medical and billing dataAnswering questions for patients an d visitorsCommunicating with patients and medical staffHelping to manage patient flow by communicating delays to patients, and announcing patient arrivals to the medical staffManaging patient details and records in accordance with patient confidentiality lawsMonitoring and stocking medical office suppliesMaintaining the waiting room or other public areasThe medical receptionist is often the first person people see when they enter a doctor’s office or other medical facility, so he or she is responsible for keeping a calm, welcoming environment for patients. This is typically a job with a standard 40-hour work week, although shifts may be necessary in medical offices that maintain weekend or overnight hours.What skills do medical receptionists have?Medical receptionists need to have solid people and administrative skills to keep things flowing efficiently in the doctor’s office.Organizational Skills:Â  Because the medical receptionist is usually the front-line person in a medical office, things need to be kept organized. We’ve all been in situations where the doctor’s office waiting room is chaotic with appointments delayed, and the medical receptionist can help manage this effectively by processing people quickly and efficiently, and making sure that all the necessary information is being communicated to the medical staff.Technical Skills:Â  The medical office may have recordkeeping software used to record patient information, so the job may require a degree of tech-savviness in addition to the usual Word and Excel skills. You should also be adept at using multi-line phone systems.Customer Service Skills:Â  Patients are customers, and the fact of being at a doctor’s office can add an extra level of stress. The medical receptionist should be friendly and good at handling people calmly, no matter what the situation may be.Time Management Skills:Â  Medical offices, especially busy ones, are based around appointment schedules. That means that as a medical receptionist, you may need to be multitasking (checking in multiple people, communicating information from the medical staff to waiting patients, processing paperwork) at any given time.What do you need to become a medical receptionist?There’s no specific degree necessary to become a medical receptionist, but you should have a high school diploma (or equivalent). Because of the administrative nature of the job, it’s typically not necessary to have specific medical knowledge. A background of basic medical knowledge and terminology can be helpful, however.How much does a medical receptionist make?The median annual salary for medical receptionists is $29,832, or $13.52 per hour, per PayScale.com. This can vary depending on whether the job is heavier on medical expertise or administrative focus.What is the outlook for medical receptionists?According to the U.S. Bureau of Labor Statistics, the demand for these receptionists is expected to grow by more than 10% by 2022- faster than average for all jobs.This can be a best-of-both-worlds job if you’re looking for an entry point into the healthcare field- you won’t be working with the gritty ins and outs of medicine, but you’ll still be an essential part of the medical office. If this sounds like the path for you, good luck!

Tin Hedgehog Experiment - Grow Tin Metal Crystals

Tin Hedgehog Experiment - Grow Tin Metal Crystals Metal crystals are intricate and beautiful. They are also surprisingly easy to grow. In this experiment, learn how to grow tin crystals that display a spiky appearance that make them look like a metal hedgehog. Tin Hedgehog Materials 0.5 M tin(II) chloride solution (SnCl2)zinc pellettest tube or vial that is larger in diameter than the zinc The rounded hedgehog shape forms around a pellet of zinc, but you can substitute any chunk of zinc metal. Since the reaction occurs at the surface of the metal, you may also use a galvanized (zinc coated) object in place of the zinc pellet. Grow a Tin Hedgehog Pour tin chloride solution into a vial. Dont fill it up all the way because you need room for the zinc.Add the zinc pellet. Set the vial somewhere stable, so it wont get bumped or jarred.Watch the delicate tin crystals grow! Youll see the beginning of a spiky hedgehog shape in the first 15 minutes, with good crystal formation within an hour. Be sure to take pictures or video of the crystals for later, since the tin hedgehog wont last. Eventually, the weight of the fragile crystals or movement of the container will collapse the structure. The bright metallic shine of the crystals will dull over time, plus the solution will turn cloudy. Chemistry of the Reaction In this experiment, tin(II) chloride (SnCl2) reacts with zinc metal (Zn) to form tin metal (Sn) and zinc chloride (ZnCl2) via a substitution or single displacement  reaction: SnCl2   Zn → Sn ZnCl2 Zinc acts as a reducing agent, giving electrons to the tin chloride so that the tin is free to precipitate.  The reaction begins at the surface of the zinc metal. As the tin metal is produced, atoms stack on top of each other in a characteristic form or allotrope of the element. The fern-like shape of the zinc crystals is a characteristic of that metal, so while other types of metal crystals may be grown using this technique, they wont display the same appearance. Grow a Tin Hedgehog Using an Iron Nail Another way to grow tin crystals is using zinc chloride solution and iron. Unless you use a round chunk of iron, you wont get a hedgehog, but you can get the crystal growth, just the same. Materials iron wire or nail0.1 M tin chloridetest tube Note: You dont need to make up a new tin chloride solution. If you have solution from the reaction with zinc, you can use that. The concentration mainly affects how quickly the crystals grow. Procedure Suspend the iron wire or nail in a test tube containing tin chloride.After about an hour, crystals will start to form. You can examine these with a magnifying glass or by removing the wire and looking at the crystals under a microscope.Allow the iron to remain in the solution overnight for more/larger crystals. Chemical Reaction Once again, this is a  simple displacement chemical reaction: Sn2   Fe → Sn Fe2 Safety and Disposal As always, its good practice to wear safety goggles and gloves when performing chemistry experiments.When you have finished the experiment, you can rinse the chemicals down the drain with water. Learn More Use a magnifying lens to compare tin crystals grown on the zinc and iron surfaces.You may wish to experiment with how changing the concentration of the zinc chloride solution or temperature of the solution affects the crystal growth rate and appearance.Try to grow other metal crystals using this technique. Keep in mind the resulting crystals might not resemble a hedgehog. To choose a subject, find a metal salt that is soluble in water, does not oxidize too quickly in air, yet can react with zinc or iron (or other metal) to form crystals. The metal needs to be more reactive than tin or the substitution wont proceed.  Its also a good idea to consider the toxicity of the metal, for personal safety and chemical disposal. You can consult the solubility rules to select good candidates for further experimentation. Sources Holleman, Arnold F.; Wiberg, Egon; Wiberg, Nils (1985). Tin. Lehrbuch der Anorganischen Chemie (in German) (91–100 ed.). Walter de Gruyter. pp. 793–800. ISBN 3-11-007511-3.Schwartz, Mel (2002). Tin and Alloys, Properties. Encyclopedia of Materials, Parts and Finishes (2nd ed.). CRC Press. ISBN 1-56676-661-3.

Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 words

Gene Prediction - Lab Report Example This corresponds to 331 codons also known as amino acids. The longest pattern always appears pink in color and the reading range was 1044 to 2039. The longest genome pattern highlighted pink was then clicked and BLAST button again clicked, the BLAST button appears at the top of the page. The BLAST button sets all the parameters as default. To check the highest bit score given by the human genome, view report button was clicked to display the results. In the results, the highest bit score realized was 675 consistent to the identities 331/331 (100%) with positives of 331/331 (100%). Gaps related to this experiment was 0/331 i.e. 0%. Still on the ORF Finder, when the button accept was clicked the longest ORF initially highlighted pink changed to green. 2 Fasta nucleotide was selected and view button clicked the sequence obtained is given below. Sequence 1 ORF: 1044 to 2039 Frame +3 ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA. Fasta formatted sequence was

What factors account for the current level of public indebtedness in Essay

What factors account for the current level of public indebtedness in the UK and what economic and fiscal measures can the UK Government use to reduce that level of debt in the next 5 years - Essay Example Even in the countries with no major affected of the financial crisis, the national debt rose approximately 20% in 2007 to 2009. United Kingdom is one of the five countries with systaltic financial crisis. In these countries the national debt is approximately 75%. Like the rest of the world, UK is greatly affected by the financial crisis that led to an increased budget deficit and public debt. The situation was alarming as the public sector total debt was  £1, 231 .7 billion by the end of November 2013, equal to 76.6% of GDP (ONS public sector finances, 2013). During the global financial crisis from mid 1990s, public sector debt fell to 29% of GDP. UK national debt witnessed an increase of 37% of the GDP from 2002 – 2007. Even during the long period of expansion the public debt in the country kept on increasing. The main reason for this was considered to be the countries increased spending on health and education (ONS public sector finances, 2013). Not only that the spending on social security was raised as well (Ecomincs Help, 2013). In UK the other reason behind the sharp increase in public debt are: The rescission 2008-2013 particularly affected the housing industry resulting the falling of house prices, low taxes and unemployment. The country has seen a sharp decline in the income tax receipt and corporation tax. These factors later exposed the structural deficit. Many financial institutions bailed out that included Northern Rock, RBS, Lloyds and other banks. Debt is considered to be a two edged sward. It is its use and application that can minimize its adverse effect. If utilized wisely it can no doubt be a support in the rough times, but if not it can result in a disaster. Still the importance of borrowing cannot be ignored in the present times. The role of borrowing at the public level has gained importance after the great recession and the public borrowing globally has increased

Identify Unnecessary Services from a Saved Vulnerability Essay Example for Free

Identify Unnecessary Services from a Saved Vulnerability Essay Nmap/Zenman is an application that allows users to scan networks to see what ports and services are open. It can be used by network security to find holes in their networks and plan what to do with them or it can be used by hackers to scan other networks to get a clear look at a networks topology and map out where everything is and plan for an attack. In this case, we have a scan of our network at Corporation Techs and need to look at what services that we have and make a decision on whether or not we should keep or get rid of them. According to the scan we have, we have a bunch of difference services that we use. Simple Mail Transfer Protocol (SMTP) is how our employees sent their mail. Post Office Protocol (POP) is the services on how we receive them. These are both important in any business so they could send and receive messages so I would not recommend closing them. As I look through more services that we have on our network, I notice that we have Sophos installed on our app server. Sophos is a company that works in anti-virus software. They been in business for a few years and to my knowledge they do a good job. However in this case we have enough anti-virus software and our network is very stable. Matter of fact, the scan also shows that we have other IDS and other services that will protect this network. I believe that Sophos is a good service but it is unnecessary at this time so I would suggest removing this. My plan for removing unnecessary services is simple. Go though our network to see we have and have not been using and make a list of services that are necessary to keep this network working. Any services that do not make the cut, gets cut.

Compare and contrast the ways In which Grace Nichols represents The Ess

Compare and contrast the ways In which Grace Nichols represents The theme of slavery in her poems I coming back and sugar cane. The two poems written by Grace Nichols are similar because both of them are about slavery. But they are very different in some ways like "I coming back" is about getting revenge and "sugar cane" is about the suffering of slaves. The styles of the poems are different from each other. This essay will try to explore these poems similarities and differences. The two poems content is different but their subject is the same. The subject is about slavery but they are written in different ways. "I coming back" is about a slave woman who want's to take revenge on her master while she is living and, when she Is dead by the help of her spirit or ghost. She wants to terrorise her master while she is living and haunt him with her spirit or ghost when she is dead. She is shown as a powerful figure that wants to take revenge on her master for treating her as a slave and an animal. She is very threatening against her master this is shown when she says "Bone in yuh throat And laugh in yuh skull I coming back." (L: 17-19) Only this sentence shows how threatening the poems could be. She has used many threatening phrases another one could be "Ball-a-fire A skinless higue I coming back." (L: 11-13) She is very repetitive on saying "I coming back." This could mean she is keen on getting revenge. "Sugar cane" describes the slave as a weak harmless person. Also in her poem she describes the kind of diseases the slave get and how. She also describes the slave as a person who can't control his life and is controlled by the master. In "sugar cane" the slave is shown as a weak pe... ...ole. "Some Creole expressions are vivid and concise and have no equivalent English." Grace Nichols said this in her introduction. She means that Creole is used for fierce things that is why it is more obvious in "I coming back" then "sugar cane." "I coming back" is more fierce than "sugar cane" that is why it is more obvious in "I coming back." Conclusion The poem has many differences and similarities although the same writer writes them. I think they are more differences than similarities. I think "I coming" is more alive and vivid of the two. "Sugar cane" is more descriptive but sad. "I coming back" is more revengeful and violent. "I coming back" is more repetitive and has limited number of lines per stanza and it uses more Creole. "Sugar cane" has more personification and it uses folklore characters. The contents of the poems are different.

Tax Treatments for Individual Returns

Use the following format for your essay. It is based on the grading rubric structure. Identify the item in the appropriate rubric area and then present your reasoning in a paragraph for each tax decision you have made. Use as much space as necessary in each category. (The task instructions give a suggested total length of 2-5 pages.Recommended Tax Filing Status The recommended tax filing status for this family is Married Filing Jointly. The reason I would recommend this filing status is that there are three children that are qualifying children, but the college freshman is not under the age of 17 so that child does not qualify for the child tax credit. Spouse B’s mother does not qualify as a dependant because she does not meet the minimum requirement of having half of her support come from the family.The family would be able to take a higher amount of deductions and therefore pay less in taxes if they choose Married Filing Jointly. By filing jointly the couple is able to take advantages of such credits as the child tax credit, the Lifetime Learning Credit & the hope credit. They are also able to save more into retirement plans than they would have been filing separately.Taxable and Non-Taxable Income Spouse A’s income from his K-1 from Fan Company A is taxable income. Spouse A’s cash withdrawals are not taxable because they are accounted for on his K-1 as part of his income from the partnership. Spouse A’s income as a part time referee is taxable. Spouse B’s earnings as the controller for the electronics firm are taxable. Dividends from Company E stocks are taxable.The interest from the municipal bond is non-taxable. The losses that Spouse B suffered from day trading would be an offset against all other taxable income and would need to be reported on Form 8949 and Schedule D. The income from the rental properties would be taxable.The gain from selling their home is not taxable because it falls within the $250,000 limit for gai ns from selling a primary residence. The $200 per month that Spouse B receives for child support is not considered taxable income.Capital Gains and Losses The $44,000 profit from the sale of the rental house is a taxable gain because it was not the family’s main residence. The $5,000 stock trading loss that Spouse B incurred would be a capital loss. But only $3,000 of the loss will be able to be deducted in the current year, the other $2,000 will be a loss carryover. The rule for Capital Gains & Losses is that when a capital asset is sold, the difference between the amount you paid for the asset and the amount you sold it for is a capital gain or capital loss.A2c. Profit or Losses from Sale of Property The profit from selling the family’s main residence is not considered to be a taxable gain because the family lived there for more than 2 years within the past 5 years and because the gain on the sale was less than $500,000. The amount of the exclusion for the couple is $296,000.Partnership Income and Losses Spouse A’s $142,000 income from his K-1 is his partnership income. This is included in his taxable income. Spouse A’s cash withdrawals are not taxable because they are accounted for on his K-1 as part of his income from the partnership. Only Spouse A’s share of the net income of the partnership is considered to be his taxable income.Passive Activity Gains and Losses The family had a passive activity loss of $6,200 from their rental properties because the family does not materially participate in the business. Passive activity losses can only offset passive activity income, and passive activity tax credits can only be used against tax attributable to passive activity income on your tax return. The $44,000 profit from the sale of the rental house is a passive gain.Adjustments to Income (on the 1040 form this area is called Adjusted Gross Income) Spouse A’s $600 monthly alimony is a deductible expense because his ex-spo use has to pay income tax Spouse A’s deductible portion of his Self Employment tax on his $142,000 partnership income would be an adjustment because an individual is able to deduct the amount of taxes that an employer would normally pay. Moving expenses are not able to be used as an adjustment to income because the family did not lessen the commute by at least 50 miles.The passive loss from the rental properties are an adjustment to gross income. The money that Spouse A contributes to his Keogh retirement plan is not an adjustment to gross income because it is not one of the specified types of retirement plans that are able to be used as an adjustment.Deductions The Family should take the standard tax deduction because I do not believe that their itemized deductions will total more than the standard deduction. The donations to charity are tax deductible as long as the couple kept up with records and can itemize each deduction. This would be reported on schedule A. Spouse Bâ⠂¬â„¢s new wardrobe for her new job is not tax deductible because the clothes can be worn for other occasions than just work. The family will not be able to take their health care costs as a deduction because the medical costs did not equal 7.5% of their income.Tax credits A tax credit is an amount of money that is able to be subtracted from the actual amount of taxes that a taxpayer owes. This will reduce the amount of taxes that the family has to pay to the IRS. Spouse A will not get a credit for his Keogh Plan contributions because the family’s AGI will be too high. The family will get a child tax credit for each of the two children under 17. It may be possible for the family to get an Education credit for their College freshman and deduct some of the eligble expenses.American Opportunity Tax Credit to deduct up to $2,500 for expenses of their college freshman. The credit is phased out for incomes above $160,000.

Chocolate by Joanne Harris Essay

If we were all to rebel against what we’ve always known to be accepted, if we were to completely ignore the teachings of our elders and do the things we’ve been taught to be â€Å"evil† and â€Å"sinister†, what would happen? This situation is one which occurs in a small and tranquil French town in the extract from Chocolat. Throughout the extract there are a variety of juxtapositions, polarizations, and much contrast building the subject. Joanne Harris creates a compelling story, but not without exaggerated or overstated situations. Through reading the extract and analyzing each significant line of literature, we are able to understand the narrator and the young girl’s character to a more advanced degree. In the extract, we first encounter Vianne with her daughter Anouk as they brave the harsh wind and settle into the new village. â€Å"We came on the wind of the carnival.† The quoted piece of literature displays the sly exotic wind, a rather unusual one for February. To some extent, the wind presents the characters of Vianne and Anouk as they are independent and wild, the same as the wind that brought in the carnival. Reminiscent of the carnival, the narrator and her daughter are very bright and lively which is ironic as they settled the grey village during the time of the carnival. This piece of text also shows polarization; Light vs. Dark and Lively vs. Dull, as well as contrast between the town’s people and the carnival. The polarization of Lively vs. Dull can be seen in the extract thro ugh the mentioning of fanciful tales. â€Å"†¦A dragon’s head on a shield, Rapunzel in a woolen wig, a mermaid with a Cellophane tail, a gingerbread house all icing and gilded cardboard, a witch in the doorway†¦.† Seeing that most of us have matured with the impression that fairy tales are magic- blissful, bright and fantastic, as we read this passage we can see how Vianne try’s to keep magic alive in Anouk as well as in herself. Their itinerant from town to town represents this burning flame; the magic she is striving to keep alive. Not only does Vianne attempt to keep magic flourishing in herself and Anouk, she also aids the parishioners. The extract is an enchanting brew of confections and humanity. Vianne, a shaman-like woman rides the North wind casting her spell of kindness to  those in need; she visits town after town seeking battles with those who would take advantage, and attempt to lord over other poor souls. Carrying on a tradition of lifting the spirits of the downtrodden, with her magical unrefined cocoa and special chili pepper in the form of delicious chocolates. This shows great contrast amongst Vianne and the villagers for the reason that, the personality of Vianne is much different than that of each person in Lansquenet. We also notice this contrast out of the text through â€Å"†¦ Her silk scarf fluttering at her throat; the child in yellow Wellingtons and sky blue mac. Their coloring marks them. Their clothes are exotic..† Unlike the town’s people, Vianne is more insightful and exotic as well as observant but nevertheless logical. This is shown in â€Å"..knowledge is currency here..† and â€Å"I feel their gaze†¦Ã¢â‚¬  As for Anouk, she is able to see beyond the truth. At first, we witness this during the carnival. â€Å"But at six the world retains a special luster.† Then, at the mentioning of a mermaid. â€Å"..a mermaid with a Cellophane tail..† She can still see the real witch, the real magic. Joanne Harris used a great juxtaposition here; magic vs. functionality. Not only does Joanne Harris use juxtapositions to build her subjects, she also employs contrast, polarization, connotations, sensuality/austerity (priest, villagers) plus flamboyant pass ages along with descriptive ones used to paint an image in the reader’s mind that appeals to our senses. For example, to appeal to our tastes Joanne Harris uses very descriptive words that are enough to make you drool. â€Å"..hot greasy scents of frying pancakes and sausages and powdery-sweet waffles..† This also creates wild images in the readers mind, tying in contrast amongst the carnival and town’s people. The fact that Vianne arrives in town on the day of the carnival just prior to lent shows great significance- Contrast to people and village is Lively vs. Grey/Dull, which ironically is seen a lot throughout the passage. The carnival also acts as a connecting thread though means of a new beginning. More precisely, a new beginning between Vianne and the villagers; almost like a â€Å"float.† In addition, the carnival sets mood and personality; the fact that everything is not always as is seen, especially when it comes to Religion where the church is a means of control. This control is used as a juxtaposition, repression, and emphasis throughout the movie as well as the passage. All the factors mentioned in the essay; character, language, connections, significance, tie in to create the  subject. The subject of how the town’s people judge Vianne and Anouk which then leads to tolerance- how the author creates the subject.

Risk Management

Risk Management Introduction Internal and external environments of an organization pose a wide range of risks to an organization and managers should establish strategies to manage risks for the long-term survival. Risk management strategies are enhanced by the culture of the organization and this can be maintained by inculcating a culture of good values, believes, norms and attitudes.Advertising We will write a custom essay sample on Risk Management specifically for you for only $16.05 $11/page Learn More Changes in the global markets today create a huge risk to organizations and this creates the need to have mechanisms to solve organizational problems in a professional manner. Thus, risk management is a crucial aspect of an organization and proper strategies need to be established to ensure the survival of organizations in the turbulent market environments (Jafari, Rezaeenour, Mazdeh, Hooshmandi, 2011). Therefore, risk management entails setting goals and objectives and e nsuring that they are achieved in the most effective manner, managing change that is brought about by introduction of new strategies, managing cultural and technological diversity among other tasks. Risk management covers a wide range of activities and aims at establishing better strategies of promoting the success of an organization. Enterprise wide risk management (EWRM) Enterprise wide risk management involves managing risks and seizing opportunities which help an organization to achieve its objectives. Managing risks as opportunities come is very important in maintaining the success of the organization. Creating value to the shareholders capital is the major bestowed upon the managers of an organization. This can be achieved by identifying opportunities available in the business environment and seizing them actively to ensure the interest of shareholders is protected. Therefore, EWRM is defined as an approach used to manage enterprises by controlling risks (Gupta, 2011). It is i mportant to note that organizations are founded on goals and it is the achievement of these goals that differentiates successful organizations from others. There are various risks associated with achieving goals and the management requires to develop strategies to reduce the effect or evaluate the impact such risks have on the organization. Organizations set goals to be achieved and these goals can only be achieved by proper planning of all resources. Risks are encountered in every situation in an organization and it is important to put clear strategies to deal with risks as they occur to avoid losses (Hepworth, Rooney Rooney, 2009).Advertising Looking for essay on business economics? Let's see if we can help you! Get your first paper with 15% OFF Learn More Therefore, it is evident that EWRM is an important aspect that determines how organization succeeds in turbulent market conditions. Managers use risk management as a benchmark to measure the achievement of an organization. An organization that is able to manage all the risk elements successfully acquires better position in the market. Most successful organizations have ventured in risky businesses and this has created a lot of wealth to the shareholders. Operating in high risk activities requires establishing a strong risk management system to ensure that the organization can not make a lot of losses in case the event of risks occurring (Mbuya, n.d.). GRC and its relationship with EWRM Governance, risk and compliance are management tools that comprise of three aspects. First, governance which refers to the process by which the top management team apply to control, plan, organize and direct the resources of an organization to achieve the goals which have been set by the shareholders. It involves making decisions by the top management by using the appropriate information. Secondly, risk management involves the identification, analysis and response to the risks affecting an organizat ion. To manage risks an organization can control, avoid, accept, or transfer the risks to other parties. Lastly, compliance deals with conforming to all requirements stipulated by the concerned stakeholders (Mohapatra, n.d.). According to Wilson and Dobson (2008) governance, risk and compliance is related to EWRM in that the management puts measures to regulate the activities of the organization to ensure that all rules and regulations are adhered to. By complying with the rules and regulations of the organization, the management ensures that it avoids the risks of penalties related to legal systems of a country. The management evaluates the costs related to the implementation of various strategies and this helps solve some problems that may affect the smooth operation of an organization. Compliance enhances the control of risks associated with the implementation of decisions made by the management of an organization (Mather, Kumaraswamy Latif, 2009). Therefore, we find out that th ere is a close relationship between GRC and EWRM because the two interact with each other. However, there are few differences between GRC and EWRM in that GRC deals with how organizations are managed and how the organization benefits when all rules and regulations are adhered to by all stakeholders.Advertising We will write a custom essay sample on Risk Management specifically for you for only $16.05 $11/page Learn More It also explains the relationship between the internal and external environmental elements and how they interact with each other. On the other hand, EWRM is based on risk management at the enterprise level and provides little interaction between the internal and external environments (Mather, Kumaraswamy Latif, 2009). Opinion about above statement a fair comment on the state of play today Enterprise wide risk management (EWRM) as an assurance tool is increasingly being mandated; indeed it is embedded as a concept in ISO31000:2009. This stat ement is a fair comment on the state of play today. Many organizations have realized the importance of managing risks and this has been facilitated by the intensifying number of risks in the market environments today. To establish better strategy for improving the competitiveness of an organization can only be made possible by managing all the risks that may be associated with the implementation of such strategies (Loras, 2010). Threats and responses to be offered There are various threats that managers encounter when maintaining values in an organization. In competitive environment organizations face threats which may hinder accomplishment of the stipulated values. Some of these threats may be cause by changes in internal and external environmental factors such macro and micro economic variables, legal factors, technological changes, political environments among others (Champoux, 2010). The response to these threats determines the success of an organization. The management responds by studying the changes in the market conditions as well as other factors that may affect the activities of the organization. Some examples of the responses that can be offered to these threats are change management, making better decisions, establishing stronger strategies, collaborating with consultants and other measures (Klein, 2011).Advertising Looking for essay on business economics? Let's see if we can help you! Get your first paper with 15% OFF Learn More Change management is an important aspect that managers need to learn when dealing with threats and responses. Moran and Brightman (2001, pg 111) have defined change management as â€Å"the process of continually renewing an organization’s direction, structure, and capabilities to serve the ever-changing needs of external and internal customers.† Change is the opening through which people or organization focus the future by bringing new systems which create success. Change can be introduced by an individual person or organization or it can be happen by itself. Change brings opportunities for growth and improvement. The management of an organization should become fast in introducing and implementing change since the world is changing at an alarming speed. Jennings and Haughton (2002) explain that the need for change has been caused by revolutionary technologies, consolidation, well-funded new competition, unpredictable customers, and a quickening in the pace of change hu rled unfamiliar conditions at management. (P. 212). Change management focuses on developing future structures of a business to improve the performance as well as introduce new technologies which improve the performance of the organization. The path towards establishing future structures should be well monitored to create a smooth transition for the organization to achieve the desired changes as well as manage risks. Crisis within the organization create the need for organizational change and the management should be prepared to handle all changes that might be required by the organization. The internal and external business environments are changing at an alarming rate and change management is an essential tool for capturing new developments being introduced. Competition in the global markets has increased and this is forcing managers to introduce innovation in the management of the systems within an organization in order to catch up with the changes (Luecke, 2003). Many changes int roduced within an organization fail due to poor preparedness as well as management of the entire process. The lack of appropriate frameworks to support the implementation and management of change within an organization are the main causes of failure by many changes introduced by the management (Burnes, 2004). The nature of organizational change has been assumed for a long period of time by managers and contemporary studies have indicated that strict measures should be introduced to cater for the gap between the success and failure of the changes being introduced by an organization. According to Edmonstone (1995) â€Å"many of the change processes over the last 25 years have been subject to fundamental flaws, preventing the successful management of change† (p. 16). Contemporary studies have identified that the pace of change management has increase in the recent years and managers are becoming more responsive to the changes in the environment (Burnes, 2004). There is no organi zation or industry is immune from change since change is caused by many internal and external factors. The introduction, implementation and monitoring of change requires the collaboration of all stakeholders to an organization. Change cannot be achieved by an individual department, or sector. The management should respond quickly to internal and external changes required by the organization. Delays in response can retard the achievement of appropriate change. Since new technologies are being introduced in the global markets each day, delay in establishing change may result into the organization adopting old systems which are not beneficial. Adequate research should be done into the recent changes in the market. There are no universally acceptable processes of creating change in an organization. The management should apply the best structures relevant to the organization (Burnes, 2004). Inculcating culture in EWRM and/ or GRC According to Kotter and Heskett (1992) culture refers to t he beliefs, attitudes, values and norms that a given people have. The organizational culture is defined by the stakeholders and this is reflected in the nature of activities the management sets. The culture of an organization is inculcated in the GRC by creating systems of compliance. Culture establishes the norms to be observed by all stakeholders and this creates the basis of compliance. Culture explains the extent to which the management can take risks while managing the resources of an organization (Klein, 2011). There are organizations which are risk-averse while others are encourage taking risks as the basis of operation. This differentiates the decisions to be made by the management during the operation and implementation of the strategies (Burnaby Hass, 2009). To achieve appropriate governance the management requires establishing better strategies of promoting the cultural morals of an organization. Cultural morals have become a major concern in the business world today bec ause organizations are operating in multicultural environments. Working with people from different cultures requires understanding the cultures of each person in the organization Global human resource management involves dealing with people from different cultures and different backgrounds. There are several advantages and disadvantages of operating global human resource management. Some companies have failed while others have acquired great success after extending their operations across the borders. Proper strategies are required in the management of employees with diversified cultures. The political, legal and social environments in the global labor markets are different and the management should be very accurate in establishing the appropriate strategies which match the particular needs of the different employees. With the increase in globalization many people are seeking employment across the borders of their domestic markets. However, organizations dealing in the international scene face some challenges when relocating employees from one country to another. There are several barriers which hinder managers of multinational companies from relocating their employees from one country to another. These barriers relate to the physical conditions, legal aspects, economics, and cultural barriers (Golembiewski, 1995). Complexity in the diverse cultures makes is difficult to operate in many countries. Several companies have failed in their strategies to operate in the global scene due to due to poor integration of the ingredients required in multinational human resources management. Global human resource management is a strategy that is gaining a lot of importance especially after the spirit of globalization started. Several companies have improved their performance after establishing proper strategies to manage their employees while others have failed due to poor integration of the required aspects of global human resources management. The need to understand the cultural differences, the diversity in economic, legal and political environments is very important when dealing with global human resources management (Burnaby Hass, 2009). The culture of an organization dictates the shape taken by the management goals and objectives. The success or failure of organizational change is determined to a great extent by the culture in the organization Cultural change is required for the achievement of successful change management strategies. The globalization of many organizations has created a scenario where multinational organizations are operating in diverse cultures where many people are involved. The integration of each cultural aspect into the processes of the organizational change is essential for the success of the organization. The global business requires applying the best strategies to achieve a competitive edge. Many global organizations have failed to venture into some countries due to poor analysis of cultural aspects of the people it is involved in. the management of change is a very important aspect in achieving success in accomplishing global goals. The management of an organization must analyze the cultural needs of all consumer groups. This will enable the management to match the cultural needs of the various consumers into the products being manufactured by the organization. In addition, the employees of the organization need to understand the cultural aspects of the organization in order to establish goals which are achievable and which will create success to the organization. Both the internal and external environmental factors should be well analyzed when integrating a culture that will create successful change management strategies (Schein, 1992). Changing culture is a systematic process which requires proper strategies to ensure all stakeholders internalize the required changes. This process is affected by factors such as the complexity, ambiguity and powers the cultural aspects of the organization. The main architects of an organizational culture are the top management individuals.The culture of an organization is developed by the people working there as well as all other internal and external stakeholders (Schein, 1992). Is it simply too expensive for value? It is not too expensive to maintain values in an organization because there are more benefits accrued from operating in an ethical manner. Values provide an organization with the guidelines to be applied in the implementation of strategies. When an organization conducts business unethically there are many costs incurred and these can only be avoided by applying the best values possible. Maintaining values improves the public image of an organization and this makes an organization achieve a competitive edge (Thompson Martin, 2005). Organizations which fail to establish a good system of values they end up incurring many losses which could have been avoided. These costs may include loss of customer trust, legal action, bad corp orate image and others. The cost of failing to maintain values in an organization is too high not only in the short run but also in the long run. Organizations which focus on existing in the market for a longer period of time use strategies which promote a good image which will attract more customers, they maintain legal ethics and other activities which improve the position of the company in the market (Cunningham, 2001). Conclusion Risk management is an important process that managers should maintain in an organization. It is inevitable to have risks and managers should have better strategies to deal with risks. The long-term survival of an organization depends on the ability to manage risks. The intensifying competition in the global markets has forced managers to focus on maintaining a strong risks management program by establishing values. Complying with the values and cultural aspects of an organization is important in achieving the goals and objectives of an organization. The culture of an organization determines its success in the market environment. It is a reflection of the beliefs and attitudes that people have towards the organizational systems. Culture is developed and shaped by the stakeholders of the organization. Change management is very important to an organization and managers should possess the required skills of carrying out this process. Therefore, risks management is an important activity for organization in the modern market environment and all managers should embrace it for the long-term survival of their businesses. List of bibliography Burnaby, P. and Hass, S. (2009). Ten steps to enterprise-wide risk management. Corporate Governance, 9(5). p. 539-550. Burnes, B. (2004) Managing Change: A Strategic Approach to Organizational Dynamics, 4th Edn (Harlow: Prentice Hall) Champoux, J. (2010). Organizational behavior: Integrating individuals, Groups, and organizations. New York: NY, Taylor Francis. Cunningham, B. J. (2001). Researching org anizational values and beliefs: the Echo approach. New York: NY, Greenwood Publishing Group. Edmonstone, J. (1995) ‘managing change: an emerging consensus’, Health Manpower Management, 21(1), pp. 16–19. Golembiewski, R. T. (1995). Managing diversity in organizations. Alabama, University of Alabama Press. Gupta, P. K. (2011). Risk management in Indian companies: EWRM concerns and issues. The Journal of Risk Finance, 12(2). P. 121-139. Jafari, M., Rezaeenour, J., Mazdeh, M. and Hooshmandi, A. (2011). Development and evaluation of a knowledge risk management model for project-based organizations. Management decision, 49(3). P. 309-329. Jennings, J. and L.Haughton. (April 16, 2002). Its not the BIG and eats the SMALL its the FAST that eats the SLOW. Harper Paperbacks; 1st edition. 288 pages. ISBN-10: 0066620546 ISBN-13: 978-0066620541 Klein, A. (2011). Corporate culture: its value as a resource for competitive advantage. Journal of Business Strategy, 32(2). p. 21-28. Kotter, J. P. and Heskett, J. L. (1992). Corporate culture and performance. New York, Simon and Schuster. Loras,J. (2010). Book Review : Strategic Risk Management Practice: How to Deal Effectively with Major Corporate Exposures. Management Decision, 49(1). p. 167-170. Luecke, R. (2003) Managing Change and Transition (Boston, MA: Harvard Business School Press). Mather, T., Kumaraswamy, S. Latif, S. (2009). Cloud Security and Privacy: An Enterprise Perspective on Risks and Compliance. New Jersey: NJ, OReilly Media, Inc. Mbuya, J. C. (n.d.). Risk management strategy. South Africa, Dr John Chibaya Mbuya. Mohapatra, (n.d.). Business Process Automation. New Delhi, PHI Learning Pvt Ltd. Moran, J. W. and Brightman, B. K. (2001). ‘Leading organizational change’, Career Development International, 6(2), pp. 111–118. Schein, Edgar. (1992). Organizational Culture and Leadership, Second Edition. San Francisco: Jossey-Bass Thompson, J. L. and Martin, F. (2005). Strategic mana gement: awareness and change. London, Cengage Learning EMEA. Wilson, S. B. and Dobson, M. S. (2008). Goal setting: how to create an action plan and achieve your goals. New Jersey: NJ, AMACOM Div American Mgmt Assn.

The Moche Culture, Guide to the History and Archaeology

The Moche Culture, Guide to the History and Archaeology The Moche culture (ca. AD 100-750) was a South American society, with cities, temples, canals, and farmsteads located along the arid coast in a narrow strip between the Pacific Ocean and the Andes mountains of Peru. The Moche or Mochica are perhaps best known for their ceramic art: their pots include life-sized portrait heads of individuals and three-dimensional representations of animals and people. Many of these pots, looted long ago from Moche sites, can be found in museums throughout the world: not much more about the context from where they were stolen is known. Moche art is also reflected in polychrome and/or three-dimensional murals made of plastered clay on their public buildings, some of which are open to visitors. These murals depict a wide range of figures and themes, including warriors and their prisoners, priests and supernatural beings. Studied in detail, the murals and decorated ceramics reveal much about the ritual behaviors of the Moche, such as the Warrior Narrative. Moche Chronology Scholars have come to recognize two autonomous geographic regions for the Moche, separated by the Paijan desert in Peru. They had separate rulers  with the capital of the Northern Moche at Sipn, and that of the Southern Moche at the Huacas de Moche. The two regions have slightly different chronologies and have some variations in material culture. Early Intermediate (AD 100-550) North: Early and Middle Moche; South: Moche Phase I-IIIMiddle Horizon (AD 550-950) N: Late Moche A, B, and C; S: Moche Phase IV-V, Pre-Chimu or CasmaLate Intermediate (AD 950-1200) N: Sican; S: Chimu Moche Politics and Economy The Moche were a stratified society with a powerful elite and an elaborate, well-codified ritual process. The political economy was based on the presence of large civic-ceremonial centers that produced a wide range of goods which were marketed to rural agrarian villages. The villages, in turn, supported the city centers by producing a wide range of cultivated crops. Prestige goods created in the urban centers were distributed to rural leaders to support their power and control over those parts of society. During the Middle Moche period (ca AD 300-400), the Moche polity was split into two autonomous spheres divided by the Paijan Desert. The Northern Moche capital was at Sipan; the southern at the Huacas de Moche, where the Huaca de la Luna and Huaca del Sol are the anchor pyramids. The ability to control water, particularly in the face of droughts and extreme rainfall and flooding resulting from the El Nià ±o Southern Oscillation drove much of the Moche economics and political strategies. The Moche built an extensive network of canals to increase agricultural productivity in their regions. Corn, beans, squash, avocado, guavas, chili peppers, and beans were grown by the Moche people; they domesticated llamas, guinea pigs, and ducks. They also fished and hunted plants and animals in the region, and traded lapis lazuli and spondylus shell objects from long distances. The Moche were expert weavers, and metallurgists used lost wax casting and cold hammering techniques to work gold, silver, and copper. While the Moche did not leave a written record (they may have used the quipu recording technique that we have yet to decipher), the Moche ritual contexts and their daily lives are known because of excavations and detailed study of their ceramic, sculptural and mural art. Moche Architecture In addition to the canals and aqueducts, architectural elements of Moche society included large monumental pyramid-shaped architecture called huacas  which were apparently partly temples, palaces, administrative centers, and ritual meeting places. The huacas were large platform mounds, built of thousands of adobe bricks, and some of them towered hundreds of feet above the valley floor. On top of the tallest platforms were large patios, rooms and corridors, and a high bench for the seat of the ruler. Most of the Moche centers had two huacas, one larger than the other. Between the two huacas could be found the Moche cities, including cemeteries, residential compounds, storage facilities and craft workshops. Some planning of the centers is evident, since the layout of the Moche centers are very similar, and organized along streets. Ordinary people at Moche sites lived in rectangular adobe-brick compounds, where several families resided. Within the compounds were rooms used for living and sleeping, craft workshops, and storage facilities. Houses at Moche sites are generally made of well-standardized adobe brick. Some case of shaped stone foundations are known in hill slope locations: these shaped stone structures  may be of higher status individuals, although more work needs to be completed. Moche Burials A wide range of burial types are evidenced in Moche society, roughly based on the social rank of the deceased.  Several elite burials  have been found at  Moche sites, such as  Sipn, San Josà © de Moro, Dos Cabezas, La Mina and Ucupe in the Zana Valley. These elaborate burials include a considerable quantity of grave goods  and are often highly stylized. Often copper artifacts are found in the mouth, hands and under the feet of the interred individual. Generally, the corpse was prepared and placed in a coffin made of canes. The body is buried lying on its back in a fully-extended position, head to the south, upper limbs extended. Burial chambers range from an underground room made of adobe brick, a simple pit burial or a boot tomb.  Grave goods  are always present, including personal artifacts. Other mortuary practices include delayed burials, grave reopenings and secondary offerings of human remains. Moche Violence Evidence that violence was a significant part of Moche society was first identified in ceramic and mural art. Images of warriors in battle, ​decapitations, and sacrifices were originally believed to have been ritual enactments, at least in part, but recent archaeological investigations have revealed that some of the scenes were realistic portrayals of events in Moche society. In particular, bodies of victims have been found at  Huaca de la Luna, some of which were dismembered or decapitated and some were clearly sacrificed during episodes of torrential rains. Genetic data support the identification of these individuals as enemy combatants. History of Moche Archaeology The Moche were first recognized as a distinct cultural phenomenon by archaeologist  Max Uhle, who studied the site of Moche in the early decades of the 20th century. The  Moche civilization  is also associated with Rafael Larco Hoyle, the father of  Moche archaeology who proposed the first relative chronology based on ceramics. Sources A photo essay on the  recent excavations at Sipan  has been constructed, which includes some detail concerning the ritual sacrifices and burials undertaken by the Moche. Chapdelaine, Claude. Recent Advances in Moche Archaeology. Journal of Archaeological Research, Volume 19, Issue 2, SpringerLink, June 2011. Donnan CB. 2010. Moche State Religion: A Unifying Force in Moche Political Organization. In: Quilter J, and Castillo LJ, editors.  New Perspectives on Moche Political Organization. Washington DC: Dumbarton Oaks. p 47-49. Donnan CB. 2004.  Moche Portraits from Ancient Peru. University of Texas Press: Austin. Huchet JB, and Greenberg B. 2010.  Flies, Mochicas and burial practices: a case study from Huaca de la Luna, Peru.  Journal of Archaeological Science  37(11):2846-2856. Jackson MA. 2004. The Chimà º Sculptures of Huacas Tacaynamo and El Dragon, Moche Valley, Peru.  Latin American Antiquity  15(3):298-322. Sutter RC, and Cortez RJ. 2005. The Nature of Moche Human Sacrifice: A Bio-Archaeological Perspective.  Current Anthropology  46(4):521-550. Sutter RC, and Verano JW. 2007.  Biodistance analysis of the Moche sacrificial victims from Huaca de la Luna plaza 3C: Matrix method test of their origins.  American Journal of Physical Anthropology  132(2):193-206. Swenson E. 2011.  Stagecraft and the Politics of Spectacle in Ancient Peru.  Cambridge Archaeological Journal  21(02):283-313. Weismantel M. 2004. Moche sex pots: Reproduction and temporality in ancient South America.  American Anthropologist  106(3):495-505.

Understanding Surveys and Samples Essay Example | Topics and Well Written Essays - 750 words

Understanding Surveys and Samples - Essay Example a hypothesis as â€Å"a tentative explanation of the research problem, a possible outcome of the research, or an educated guess about the research outcome† (Hatch, 2002). Thus, a hypothesis is a temporary prediction about the nature of the relationship that exits between two or more variables. The study has developed the following two hypotheses that take both the null and alternative approach. The analysis of two or more variables together makes it important for the researcher to point out the relationship between the two variables involved in the study. Two variables are independent if a change in one does not consequently cause a change in the other. In the case that one of the variables causes a change in the other then the first variables is known as an independent variable and the latter a dependent variable (Sharp, Peters, & Howard, 2002). In the two questions identified above, domestic violence in the first question is the independent variable while psychological consequences are the dependent variable. In the second question, the independent variable is psychological problems while the dependent variable is the normal development. The following definitions will act as operational definitions for the following variables used in the study. These are based on the various understandings by different scholars on the meaning of the terms and how they are used in day to day interactions. Domestic violence will be taken to mean developed pattern of assaultive and coercive behavior which could take the form of physical, psychological, emotional or economic coercion that is seen to occur between a couple (Champion, 2000). This definition will thus focus on the family where children exist and not any other adult relationship. The definition will only consider what the children can see happen in the family and not what they are not able to observe. Psychological problems will be taken to represent patterns of behavior or psychological symptoms that have an effect

Risk Management table Essay Example | Topics and Well Written Essays - 500 words

Risk Management table - Essay Example This is due to the fact that, probability mainly defined the expected number of times that a particular impact can happen. Therefore, if the impact is high and the probability is also high, then the team ranked this as a top threat. Contrastingly, if both are low then that particular threat was ranked at the lowest level (Wheeler, 2011). The reasoning behind the mitigation steps for different types of threats is as stipulated below. If a threat affects the operations of a network device, then the mitigation steps shed light on protecting its data storage locations along with its network access layer. Secondly, if the threat is due to poor user practices, the mitigation steps focused on coming up with the proper policies on the use of organization resources. Lastly but certainly not the least, if a particular threat affected a whole system, then focus was laid on configuring the interconnection devices such as routers and switches (Wheeler,

Principles of Marketing Financial Services Essay

Principles of Marketing Financial Services - Essay Example Around the world, financial services organizations are driven to increase revenues while decreasing costs. They need the ability to quickly go to market with new products, deepen customer relationships, increase revenue per customer, and improve the accuracy of their strategic decision making. At the same time, they need to control operational and compliance costs, ensure interoperability of existing applications and infrastructure, and provide seamless interactions with their customers. All within an increasingly complex compliance environment. High-performance financial institutions understand the link between operational performance and financial performance. The ability to uncover and turn vital insights into operational value levers—such as customer-facing activities, exposure to credit risk, and market share—and link them to financial value levers like operating margin, loan-loss ratios, and cost of assets in a timely and accurate fashion is key to optimizing over all performance and driving value creation. Abbey’s vision is to be the outstanding financial services company in the UK. It is the sixth largest bank in the United Kingdom and aims to achieve the largest position in the market. The purpose of Abbey is to achieve above average growth in share holder value over the long term by meeting stakeholders needs. A detailed and more specific description of the products and services offered by Abbey includes – Current Accounts, Credit Cards, Loans, Mortgages, Insurance, Savings, ISAs and Child Trust Fund. ... The ability to uncover and turn vital insights into operational value levers-such as customer- facing activities, exposure to credit risk, and market share-and link them to financial value levers like operating margin, loan-loss ratios, and cost of assets in a timely and accurate fashion is key to optimizing overall performance and driving value creation -> Abbey An Overview : Vision: Abbey's vision is to be the outstanding financial services company in theUK. It is the sixth largest bank in the United Kingdom and aims to achieve thelargest position in the market. Purpose: The purpose of Abbey is to achieve above average growth in shareholder value over the long term by meeting stake holders needs. Products and Services: A detailed and more specific description about theproducts and services offered by Abbey includes - Current Accounts, CreditCards, Loans, Mortgages, Insurance, Investments and Pensions, Savings, ISAs and Child Trust Fund. Strategies Implemented : The right mixture of strategies which suits the market place and customers are being implemented so that there would be an optimum utilization of resources and maximization of profits can be achieved. -> SWOT Analysis : Its main strength is its expert knowledge of finance. This meant that it should focus on this area. Its main weakness is its size. As only the sixth largest bank it could not offer thesame range of products as bigger banks. This meant that it should offer a simplerange. The main opportunity was to provide simpler products which customer wouldbetter understand. The main threat is from other banks, who might want to take over Abbey, so it

Information Security

Information Security Introduction The requirements of information security with in an organization have undergone major changes in the past and present times. In the earlier times physical means is used to provide security to data. With the advent of computers in every field, the need for software tools for protecting files and other information stored on the computer became important. The important tool designed to protect data and thwart illegal users is computer security. With the introduction and revolution in communications, one more change that affected security is the introduction of distributed systems which requires carrying of data between terminal user and among a set of computers. Network security measures are needed to protect data during their transmission. The mechanisms used to meet the requirements like authentication and confidentiality are observed to be quite complex. One must always consider potential counter measures while developing a particular mechanism. It is also important to identify implementations to adopt these mechanisms. Security mechanisms usually involve more than a particular algorithm or protocol. It means that participants be in possession of some secret information, which raises doubts about their creation, distribution and protection of that secret information. Thus a model has to be developed within which security services and mechanisms can be viewed. To identify the security needs of an organization at its effective level, the manager needs a systematic way. One approach is to consider three aspects of information security that is Security attack, Security mechanism and Security services. Security attack identifies different modes by which intruder tries to get unauthorized information and the services are intended to counter security attacks, and they make use of one or more security mechanisms to provide the service. As information systems become ever more active and important to the conduct of activities, electronic information takes on many of the roles earlier being done on papers. Few information integrity functions that the security mechanism has to support are security and confidentiality of the data to be transmitted and authentication of users. There is no single mechanism that will provide all the services specified. But we can see that one particular element that specifies most of the security mechanisms in use: cryptographic techniques. Encryption or encryption like transformations of information is the most common means of providing security. A model for much of what we will be discussing is captured in general terms. Encryption Model This general model shows that there are four basic tasks in designing a particular security service. Design an algorithm for performing encryption decryption process. Generate the secret information with the help of algorithm of step 1. Identify methods for the distribution and sharing of secret information. Identify rules to be used by both the participating parties that makes use of security algorithm and the secret information to achieve a particular security service. A crypto system is an algorithm, plus all possible plain texts, cipher texts and keys. There are two general types of key based algorithms: symmetric and public key. With most symmetric algorithms, the same key is used for both encryption and decryption. Symmetric-key encryption Execution of symmetric-key encryption can be highly useful, so that users do not experience any significant time delay because of the encryption and decryption. Symmetric-key encryption also provides a degree of authentication, since information encrypted with one symmetric key cannot be decrypted with any other symmetric key. Thus, as long as the symmetric key is kept secret by the two parties using it to encrypt communications, each party can be sure that it is communicating with the other as long as the decrypted messages specify a meaningful sense. Symmetric-key encryption will be successful only if the symmetric key is kept secured by the two parties involved. If anyone else discovers the key, it affects both confidentiality and authentication. The success of a symmetric algorithm rests in the key, divulging the key means that any one could encrypt and decrypt messages. As long as the communication needs to remain secure, the key must be protected between the participating parties. Encryption and decryption with a symmetric algorithm are denoted by E K (M) = C D K (M) = P Symmetric algorithms can be divided into two categories. Some operate on the plain text a single bit or byte at a time, these are called stream algorithms or stream ciphers. Others operate on group of bits or characters. Such algorithms are called block algorithms. Public algorithms are designed so that the key used for encryption is different from the key used for decryption. The algorithms are called public key because the encryption key be made public. It involves a pair of keysa public key and a private keyassociated with an entity that needs to authenticate its identity electronically or to sign or encrypt data. Further more the decryption key cannot be calculated from the encryption key. Each public key is published, and the corresponding private key is kept secret. Data encrypted with ones public key can be decrypted only with his private key. shows a simplified view of the way public-key encryption works. Public-key encryption Compared with symmetric-key encryption, public-key encryption requires more computation and is therefore not always appropriate for large amounts of data. However, its possible to use public-key encryption to send a symmetric key, which can then be used to encrypt additional data. This is the approach used by the SSL protocol. This provides Authentication, Integrity Confidentiality of Information at low computing power. Nevertheless, private-key encryption is useful, because it means you can use your private key to sign data with your digital signaturean important requirement for electronic commerce and other commercial applications of cryptography. Encryption and decryption can be represented in a public key scheme is E Kpu(M) = C D Kpr(C) = M Where Kpu is the public key and Kpr is the private key. In public key encryption there is always a possibility of some information being leaked out. A crypto analyst tries to get some information based on ones public key. Not a whole of information is to be gained here, but there are potential problems with allowing a crypto analyst to encrypt random messages with public key. Some information is leaked out every time to the crypto analyst, he encrypts a message. In probabilistic Encryption, multiple cipher texts are generated for one plain text, a cryptanalyst can not generate any information by chosen plain text and chosen cipher text attacks. Probabilistic encryption Security Analysis of algorithms: Different algorithms offers different degrees of security, it depends on how hard they are to break. If the cost required to break an algorithm is greater than the value of the encrypted data, then we are probably safe. If the time required to break an algorithm is longer than the time that the encrypted data must remain secret, then we are probably safe. If the amount of data encrypted with a single key is less than the amount of data necessary to break the algorithm, then we are probably safe. An algorithm is unconditionally secure if, no matter how much cipher text a crypto analyst has, there is not enough information to recover the plain text. In point of fact, only a one time pad is unbreakable in a cipher text only attack, simply by trying every possible key one by one and by checking whether the resulting plain text is meaningful. This is called a brute force attack. Cryptography is more concerned with crypto systems that are computationally infeasible to break. Any algorithm is considered computationally secure if it cannot be broken with available resources. The complexity of an attack can be measured as Data Complexity, the amount of data needed as input to the attack, Processing complexity, the time needed to perform the attack and storage requirements which are the amount of memory needed to do the attack which is space complexity. As a thumb rule, the complexity of an attack is taken to be minimum of these three factors. Another classification of complexities is by complexity of the algorithm by its construction and complexity of the algorithm by its strength. By its construction, the time complexity of the algorithm can be calculated by executing through the steps of the algorithm, which will be referred as O(n). Complexities can also be expressed as orders of magnitude. If the length of the key is k, then the processing complexity is given by 2k . It means that 2 k operations are required to break the algorithm. Then the complexity of the algorithm is said to be exponential in nature. A desirable property of any encryption algorithm is that a small change in plain text or the key should produce significant change in cipher text. Such an effect is known as avalanche effect. The more the avalanche affects of the algorithm, the better the security. Crypto analysis is the study of recovering the plain text with out access to the key. It may also find weakness in a crypto system that eventually leads to previous results. An attempted crypto analysis is called an attack. There are five types of attack. Each of them assumes that the crypto analyst has complete knowledge of the encryption algorithm used. Cipher text only attack: Here the crypto is in hold of cipher text only. The crypto analyst has cipher text of several messages, all of which have been encrypted using the same encryption algorithm. The crypto analysts job is to recover the plain text of as many messages as possible, or better yet to deduce the key used to encrypt the messages, in order to decrypt other messages encrypted with the same keys. Known Plaintext attack: The crypto analyst is in hold of not only to the cipher text of several messages, but also to the plain text of those messages. His job is to get the key used to encrypt the messages or an algorithm to decrypt any messages encrypted with the same key. Chosen Plaintext Attack (CPA): Here the crypto analyst is in hold of not only cipher text but also parts of chosen plain text. If the analyst is able to insert into the system a message chosen by the analyst, then such an attack is known as chosen plain text attack. Differential crypto analysis is an example of this mode. Chosen cipher text attack (CCA): Under the CCA model, an adversary has access to an encryption and a decryption machine and must perform the same task of distinguishing encryptions of two messages of its choice. First, the adversary is allowed to interact with the encryption and decryption services and choose the pair of messages. After it has chosen the messages, however, it only has access to an encryption machine. Chosen text: In this model, the analyst posses the encryption algorithm, Cipher text to be decoded, plain text message chosen by the crypto analyst and purported cipher text chosen by the crypto analyst. Present work: In this work an attempt has been made to generate a set of algorithms which provides security to data transmitted. The first algorithm considers a random matrix key which on execution by a series of steps generates a sequence. This sequence is used a sub key to build three different encryption models. Each model can be used for encryption of data. The second algorithm considers not only the key but also initialization vector and a time stamp to generate sub keys which are used for encryption process. And also a mechanism has been discussed which identifies any garbled key while transmitted from the Key Distribution Centre. In this work both the algorithms are discussed in terms of computational security, computational complexity and computational overhead. Both the algorithms are studied for their strengths and limitations. A crypto analytical study of the algorithms with emphasis on probabilistic encryption is also considered in this study. The encryption algorithms are compared with standard algorithms like RC4 and DES. The algorithms are also discussed in terms of its applications and also about their advantages and limitations in network security environment.

Importance of Fear in The Lord of the Flies Essay -- Lord of the Flies

Importance of Fear in The Lord of the Flies   Ã‚  Ã‚  Ã‚  Ã‚   The boys in the book, The Lord of the Flies, are controlled by their fear of the beast.   This fear is not of the beast itself, but of the unknown. It comes from not knowing whether or not a beast exists.    The children start as one united group.   They are a community in their own.   Slowly, rules started to get broken, individuals began to leave, and the group broke apart.   The one thing that causes this break-up is the beast. The beast means different things to everyone, but each boy is afraid of it.      Ã‚  Ã‚  Ã‚  Ã‚   All of this fear starts at one of the very first assemblies when a littlun says that he saw a beastie in the forest.   "Now he says it was a beastie" (35).   Everyone is already a little afraid of being on the island alone, without any adults, but this makes them even more scared.   Ralph, the chosen leader, feels this fear and notices it among the other boys.   He tries to reassure the others as well as himself with, "You couldn't have a beastie, a snake-thing, on an island this size.   You only get them in big countries, like Africa, or India" (36).   He continues trying to ease the fear by ending the conversation of beasties with, "...I tell you there is no beast" (36).   In addition, Ralph tries to have an optimistic look on rescue, and talks of fun on the island to help the children stay calm.      Ã‚  Ã‚  Ã‚  Ã‚   Jack and Ralph continue discussing the issue of fear, without the littluns present, to avoid frightening them further.   Mostly they discuss how the littluns scream out in their dreams because they are so afraid.   Simon joins in on one of their conversations on page 52:      Ã‚  Ã‚  Ã‚  Ã‚   "'As if it wasn't a good island.'   Ã‚  Ã‚  Ã‚  Ã‚   Ast... ...      Ã‚  Ã‚  Ã‚  Ã‚   By the end of the novel, it is not the beast that has driven the boys to savagery; it is their fear of the beast.   Most of the boys try to deal with their fear by pushing it away, but it is always in the back of their minds, controlling every move they make.   They do not know whether or not there is a beast on the island.   They are afraid of the unknown.   Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚     Ã‚  Ã‚  Ã‚  Ã‚     Ã‚   Works Cited. Baker, James R. "Why It's No Go." Critical Essays on William Golding. Ed. James R. Baker. Boston: G.K. Hall & Co., 1988. Golding, William. Lord of the Flies. London: Faber and Faber, 1958. Hynes, Samuel. "William Golding's Lord of the Flies." Critical Essays on William Golding. Ed. James R. Baker. Boston: G.K. Hall & Co., 1988. Moody, Philippa. Golding: Lord of the Flies, a critical commentary. London: Macmillan, 1964.         

Philosophy of Teaching Essay

Philosophy of teaching is a self-reflective statement of your beliefs about teaching and learning. It discuss how you put your beliefs in practice by including concrete examples of what you do or anticipate doing in class. My teaching philosophy is ‘participatory learning’. It a type of learning process whereby learners are put in the centre of every learning situation, in other words pupils take active part of the lesson presentation. . I hold this belief in the sense that, when children are involve actively in the lesson delivery with the relevant teaching methods and techniques and also appropriate learning materials, it’s inspires them to explore and take up their own responsibility. This belief once again, gives children the opportunities to discuss, talk and ask questions. It also allow the teacher to listen to the children and see how their understanding is developing, it makes learning permanent in any learning situation. Validity of my philosophy To validate my philosophy, James Hartley (1998) said that activity is very important in learning. Learning is better when the learner is active rather than passive; therefore learning by doing is to be applauded. My teaching style can best be described as one that incorporates different methods and techniques that encourages learners to be active participant in the delivering of lesson. By engaging students in variety of activities that address each child’s learning style, I believe that they will achieve academic success and build the self confidence. Learning occurs when a student is fully encouraged in the process, make a personal connection with the information taught and apply the knowledge to variety of experiences. When this happened the child is inspired to become engaged over and over again, make connections and apply his or her knowledge. Application of my philosophy I understand the importance of using participatory learning to appropriately address the different learning styles and needs of students in order to become effective in the near future. Consequently, it is extremely important to determine each child’s dominated learning style and continually monitor each student’s academic progress through a variety of assessment in order to plan instructions that draw upon each child’s strength to improve academic development. With my teaching philosophy in mind, I try my best to prepare my lesson before time, rehearse on my own base on the teaching and learning materials prepared and available. Introduction of which is an important part of lesson delivery is done first based on the relevant previous knowledge of student then proceed to tell them objectives of the lesson and the future benefit of the topic. In doing so the learner become informed of what would be discussed as the lesson proceed, they think critically and consciously about each objectives. For example I taught the topic shapes and space with the sub topic solid shapes. I used variety of relia like Milo tin, milk tins paper boxes, match boxes, etc. During the presentation stage l allowed pupils to have a look at the TLMs. Teacher then assisted pupils to explore the materials and came out with their own findings. Pupils discussed their findings to identify the shapes as solid shapes while teacher served as a facilitator. Teacher also assisted pupils to identify the parts of the various solid shapes talked about. Likewise in all the topics I treated during the program I used methods and techniques that allowed pupils to fully participate in the lessons. Such techniques include activity method, demonstration, discussion, games, etc. As a teacher I only served as a facilitator and guide to all the activities that went on during teaching and learning process. Effectiveness This philosophy â€Å"participatory learning† with the needed teaching and learning materials is very effective as it enhance pupils taking part fully in the lesson that is they communicate, ask questions, write down points and share ideas with friends. Conclusion I will therefore conclude that when a teacher impact knowledge by involving pupils in every activity or lesson, with appropriate, adequate and suitable learning materials using a variety of teaching techniques such as demonstration, dramatization and role play, the teacher will achieve his or her set goals and get the needed feedback from pupils. This also makes learning more practical and permanent.