Thursday, December 26, 2019
apocope - definition and examples of apocope in English
Apocope is aà rhetorical term for the omission of one or more sounds or syllables from the end of a word. Also called end-cut, apocope is a type of elision. Etymology: From the Greek, to cut off Examples and Observations In many poor neighborhoods, the Sandinista Front has more street cred than the local youth gang.(Tim Rogers, Even Gangsters Need Their Mamas. Time magazine, Aug. 24, 2007)Season your admiration for a while with an attent ear.(William Shakespeare, Hamlet, Act I, scene 2)Loss of sounds from the end of a word is known as apocope, as in the pronunciation of child as chile.(Thomas Pyles and John Algeo, The Origins and Development of the English Language. Harcourt, 1982)After he left the city, thousands of people toasted him with beer at a barbie, an Australian barbecue.(Pope in Australia, The New York Times, Dec. 1, 1986)Newspapers have their own style and it is important that your feature matches it. For instance, it would be pointless writing a feature for a staid weekly in the style of something more suitable for a lads mag.(Susan Pape and Sue Featherstone, Feature Writing: A Practical Introduction. Sage, 2000) New Words and Names Quite a few English words have resulted from apocope, among them cinema (from cinematograph) and photo (from photograph). Names often undergo apocope (e.g., Barb, Ben, Deb, Steph, Theo, Vince).(Bryan Garner, Garners Modern American Usage. Oxford University Press, 2009) Lost Vowels Apocope is a process that deletes word-final segments, including unstressed (reduced) vowels. In Middle English, many words, such as sweet, root, etc. were pronounced with a final [e], but by the time of modern English, these final reduced vowels had been lost. We still see signs of final reduced vowels in the archaic spelling of words like olde.(Mary Louise Edwards and Lawrence D. Shriberg, Phonology: Applications in Communicative Disorders. College-Hill Press, 1983)Oliver Sacks on His Favorite WordOne of my favorite words is apocope--I use it (for example) in A Surgeons Life: . . . the end of the word omitted by a tactful apocope (Anthropologist on Mars, Vintage, p. 94).I love its sound, its explosiveness (as do some of my Tourettic friends--for when it becomes a four-syllable verbal tic, which can be impaired or imploded into a tenth of a second), and the fact that it compresses four vowels and four syllables into a mere seven letters.(Oliver Sacks, quoted by Lewis Burke Frumkes in Favorite Words of Famous People. Marion Street Press, 2011) Pronunciation: eh-PAHK-eh-pee
Wednesday, December 18, 2019
China Sea And Chinese Foreign Policy - 1218 Words
The general consensus among academics and experts in the field of politics concludes that China is assertive. The assertive conduct of China can have an impact on the regional order and stability in South China Sea. The academics and experts in politics have different perspective on the assertive behaviour of Chinese foreign policy. The argument in favour of implementing assertive foreign policies affirms that China has good intentions regarding the South China Sea. China is required to have an assertive behaviour to bring regional stability and solve the territorial disputes on the South China Sea. The opposing argument on assertive foreign policies displays concerns with the aggressive and provocative behaviour of China (Chen, Pu â⬠¦show more contentâ⬠¦The maritime claims and sovereign claims of China in the South China Sea through the nine-dash line must comply with the UN Convention on the Law of the Sea (Rapp-Hooper, 2016, 78). ââ¬Å"China had historic rights to the Sou th China Sea through the nine-dash line until it ratified the UNCLOS in 1996â⬠(Rapp-Hooper, 2016, 78). China is bound to follow the international law to defend its sovereign rights despite the tribunal in the Hague ruling in favour of the Philippines (Rapp-Hooper, 2016, 81). The ruling of the tribunal in The Hague was hard on China (Rapp-Hooper, 2016, 78). The ruling has placed limitations to the maritime claims of China in the South China Sea (Rapp-Hooper, 2016, 80). The maritime claims of China to water and airspace was declared invalid under international law (Rapp-Hooper, 2016, 76). China ââ¬Å"cannot legally continue to declare military zones in the water or airspace around the reefs it occupies, nor can it do so more than 12 nautical miles from the rocks it controlsâ⬠(Rapp-Hooper, 2016, 80). The invalidated the maritime claims of China to the waterways in the South China Sea through the nine-dash line (Rapp-Hopper, 2016, 77-78). China had sought to get entitlement to the South China Sea through Itu Aba (Rapp-Hooper, 2016, 79). The tribunal declared that Itu Aba was not an island like the Spratly Islands and China could not legally claim the entire South China SeaShow MoreRelatedChinese Foreign Policy And Its Effect On The Regional Order And Stability Of South China Sea1338 Words à |à 6 Pagesconsensus among scholars concludes that China is assertive (Chen, Pu Johnston, 2014, 176). The assertive conduct of China can have an impact on the regional order and stability in South China Sea. The scholars have different views on the assertiveness of Chinese foreign policy (Chen et al., 2014, 176). The argument in favour of implementing assertive foreign policy affirms that China has good intentions regarding the South China Sea (Chen et al., 2014, 181). China is required to have an assertive conductRead MoreChinas Expansion Into The South China Sea Case Study1351 Words à |à 6 PagesAround the year 2015 China has started building artificial islands on disputed territory in the South China Sea for the purpose of resource mining, installment of surveillance and defensive infrastructures. Countries in the South China Sea that lay economic and territorial claims such as the Philippines, Malaysia, and Japan have expressed sec urity concerns regarding Chinaââ¬â¢s aggressive expansion unto territories such as the Spratyl Islands and Rubi Reef as China had increased security and surveillanceRead MoreChina Foreign Policy800 Words à |à 4 PagesXi Jinpingââ¬â¢s regime, foreign policy is both continuity and changes. The continuity is that China has still concerned on peaceful development by increasing connection with neighbors . But Chinaââ¬â¢s foreign policy has some changes to be more proactive approach, strengthen relationship with ASEAN, achieve common development and build community of common destiny which China aims to achieve as a leadership role through Chinese initiatives such as AIIB and RCEP. Beyond investment, China want to be at leastRead MoreEssay On China Global Power1260 Words à |à 6 Pagesheavy-handed foreign policy towards its neighbors. Internal disputes have included a political crisis in Hong Kong over the right to vote, minority oppression in Inner Mongolia, and unhealthy ai r quality. Chinaââ¬â¢s rise has changed the Asian power dynamic. Chinese foreign policy towards North Korea, protective in nature, has drawn criticism. Worried about instability in Korea driving untrained refugees into China, its leadership opposes any transformative actions in the region. Chinaââ¬â¢s policy towards JapanRead MoreAustralian Chinese Relations : Australia s Largest Trading Partner1285 Words à |à 6 PagesThe Australian-Chinese relationship stands as an important symbol for international relations in the Asian region. Presently, Australian face an important juncture in their relationship with China. Should Australians be concerned with Chinese military aggressions in the South China Sea or be more focused on strengthening an already strong Australian-Chinese economic partnership? China is Australiaââ¬â¢s largest trading partner and has been a vehicle for Australian economic growth in recent decades (DrysdaleRead MoreThe Rise Of Pollution Levels1204 Words à |à 5 Pages There I was in Shanghai, China, staring at the sun as if I were trying to look at a lamp behind a curtain. The rise of pollution levels in China has intrigued the minds of people who never even cared about the environment before. The Peopleââ¬â¢s Republic of China is now the largest emitter of CO2 in the world. But of course, this a global phenomenon: a global phenomenon that in no way started with China as Alanna Mitchell would agree to. By the end of the 19th century, the powerful duo that was industrializationRead MoreXi s Consolidation Of Power : Why China May Define Our Future World Order1485 Words à |à 6 PagesXiââ¬â¢s Consolidation of Power: Why China May Define our Future World Order On October 27th 2016, the world watched as China officially named its President Xi Jinping the ââ¬Ëcore leaderââ¬â¢ of the Chinese Communist Party (CCP) at the Sixth Plenum of the 18th CCP Central Committee. In the new directive released through state media, all party members should ââ¬Å"closely unite around the party center with Comrade Xi Jinping as the core...and unswervingly safeguard the party leadershipââ¬â¢s authority and centralizedRead MoreChina s Become A Global Superpower And Its Transformation From A Development Aid Recipients767 Words à |à 4 Pages I once regretted that I majored in Chinese Language and Literature. Even after completing my Master s degree in China I could not see the practical use of my studies. However, now I think it has become my strength to comprehend Chinese Language and culture as a student who seeks to research on the International Studies related to China as a Ph.D. candidate. During my study in China, I witnessed Chinaââ¬â¢s emergence as a global superpower and its transformation from a development aid recipient toRead MoreThe Function of the Truman Doctrine and Marshall Plan in Preventing the Spread of Communism During the Cold War952 Words à |à 4 PagesThe foreign policy of the United States during the Cold War fully supported the growth of democratic nations. The USSR, however, wanted countries to become communist like them. These opposing views led to tension between the two nations. As a result, in 1947, President Truman issued the Truman Doctrine which stated that the United States would supply aid to any country as long as they pledged to be democratic. The Marshall plan was enacted in 1948 and it was similar to the Truman Doctrine exceptRead MoreChina And China1145 Words à |à 5 Pagesclash into war. United States and China have high economic interdependence as the United Kingdom and Germany before WW I. In short, the fact that both stat es could go to war is not out of the question. North Korea has been recently menacing the United States in its pursuit of the nuclear military capability. Although that threat is dangerous, it is not the greatest for the United States. Considering the current strategic environment, the rise of a nationalist China is the greatest threat that the
Tuesday, December 10, 2019
Challenges of the New Century free essay sample
This paper looks at the future of business in the 21st century, and changes that should occur in organizational structures and management. This paper presents a look at two of the main challenges that are going to face businesses in the 21st century. We will write a custom essay sample on Challenges of the New Century or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page The author takes the reader on a tour of possible challenges and details why they will occur and what might be done about them. The paper discussed the impact that is likely to happen to organizational structure as well as management practices. Business has been around since the beginning of time. As the world has evolved so have the businesses. Each time technology moves us a bit further along on the time line of history we move the ways we do business to accommodate the changes. The technological boom of the last three decades however, has provided us with means that we never dreamed possible. While this is a positive change for many areas of business it is also a challenge as we move into the 21st century. There are two essential challenges that will occur going into the next century and the management practices and organizational. Structure will have to change to accommodate them. The advent of the Internet as well as telecommuting is both relatively new business components. Each of them has advantages as long as business management and organizational structure change with them.
Monday, December 2, 2019
Prometheus Essays - Prometheus, Titans, Greek Mythology, Hera, Io
Prometheus Though long engraved into history, the ancient world of Greece still remains present throughout the cradle of humanity in several ways. Its rich contributions in literature, drama and art have shaped even modern civilizations. Through the characters in the Greek myths, morals and standards that remain to dominate society are presented to us. These figures in mythology appeared as gods, goddesses, heroes, and even mortals, who teach not just through their triumphs but also through their less honorable moments. One of the most noble of these characters, was Prometheus. Prometheus was a Titan (or elder god) who could often see into the future. He first enters mythological tales when he aided Zeus in the struggle to claim the throne of King of the Gods. Several later stories portray Prometheus character as intelligent, philanthropic, and non compliant when faced with injustices. The great hero Hercules was brave and strong, but there was something he lacked. It is carefully noted along with his story that he was weak in the area of intelligence, his major disadvantage. This is a quality Prometheus possessed. Prometheus is labeled throughout mythology as being very wise. In some stories he is called the wisest in the universe. This is a feature not many other figures in mythology possessed. It was due to his wisdom that his family survived the great flood and humans received many of their advantages. Prometheus is depicted as helping humans throughout Greek mythology. In one story, he consoles Io, a young girl punished due to Heras jealousy, during her time of pain and confusion. In this story he directs her to a more promising future. There is also strong emphasis on his assisting the human race as a whole. It was Prometheus who made mankind the superior race. He gave man both the superior protection, fire, and superior form, upright like the gods. Zeus was angered when Prometheus gave man so many advantages, and also because he would not reveal whom the future told would dethrone him. Forgetting the debt he owed Prometheus for all he had helped him with in the past, he decided to torture Prometheus until he revealed the information he knew. Prometheus was bound to the rocky peak on Caucasus, wrapped in unbreakable chains, unable to sleep or relax. Everyday an eagle came down and tore at his flesh. Prometheus knew he had served Zeus well and was right in his assistance to man. He refused to yield to Zeus, and endured the pain. His body was bound but his spirit was free. He now remains a symbol of rebellion against injustice to many. In summary, along with its culture and values, ancient Greece has left us more. It has left us great figures to look up to and admire. It has left us characters such as Prometheus to pave a road of morals and standards for the present as well as future. His qualities of wisdom, altruism, and strong will have been revealed through both his stories of triumphs and pain, stories that never die. These stories will be told for generations to come. Bibliography ff Mythology Essays
Wednesday, November 27, 2019
How to become a medical receptionist
How to become a medical receptionist Careers in healthcare are booming right now. With significant advances in technology changing the game and an ever-larger population in need of healthcare services, itââ¬â¢s one of the biggest growth industries for the foreseeable future. But what if youââ¬â¢re not as interested in the hands-on medical end of things, or your skills are more administrative in nature? Becoming a medical receptionist could be the right path for you, with the best of both worlds. What does a medical receptionist do?Medical receptionists have many of the same duties as receptionists in other industries, but with a healthcare twist- managing patient records, taking initial medical information when a patient comes in, and managing day-to-day tasks for a medical office. A medical receptionistââ¬â¢s responsibilities may include the following:Answering phones and greeting patients in the officeTaking preliminary patient information, including medical and billing dataAnswering questions for patients an d visitorsCommunicating with patients and medical staffHelping to manage patient flow by communicating delays to patients, and announcing patient arrivals to the medical staffManaging patient details and records in accordance with patient confidentiality lawsMonitoring and stocking medical office suppliesMaintaining the waiting room or other public areasThe medical receptionist is often the first person people see when they enter a doctorââ¬â¢s office or other medical facility, so he or she is responsible for keeping a calm, welcoming environment for patients. This is typically a job with a standard 40-hour work week, although shifts may be necessary in medical offices that maintain weekend or overnight hours.What skills do medical receptionists have?Medical receptionists need to have solid people and administrative skills to keep things flowing efficiently in the doctorââ¬â¢s office.Organizational Skills:à Because the medical receptionist is usually the front-line person in a medical office, things need to be kept organized. Weââ¬â¢ve all been in situations where the doctorââ¬â¢s office waiting room is chaotic with appointments delayed, and the medical receptionist can help manage this effectively by processing people quickly and efficiently, and making sure that all the necessary information is being communicated to the medical staff.Technical Skills:à The medical office may have recordkeeping software used to record patient information, so the job may require a degree of tech-savviness in addition to the usual Word and Excel skills. You should also be adept at using multi-line phone systems.Customer Service Skills:à Patients are customers, and the fact of being at a doctorââ¬â¢s office can add an extra level of stress. The medical receptionist should be friendly and good at handling people calmly, no matter what the situation may be.Time Management Skills:à Medical offices, especially busy ones, are based around appointment schedules. That means that as a medical receptionist, you may need to be multitasking (checking in multiple people, communicating information from the medical staff to waiting patients, processing paperwork) at any given time.What do you need to become a medical receptionist?Thereââ¬â¢s no specific degree necessary to become a medical receptionist, but you should have a high school diploma (or equivalent). Because of the administrative nature of the job, itââ¬â¢s typically not necessary to have specific medical knowledge. A background of basic medical knowledge and terminology can be helpful, however.How much does a medical receptionist make?The median annual salary for medical receptionists is $29,832, or $13.52 per hour, per PayScale.com. This can vary depending on whether the job is heavier on medical expertise or administrative focus.What is the outlook for medical receptionists?According to the U.S. Bureau of Labor Statistics, the demand for these receptionists is expected to grow by more than 10% by 2022- faster than average for all jobs.This can be a best-of-both-worlds job if youââ¬â¢re looking for an entry point into the healthcare field- you wonââ¬â¢t be working with the gritty ins and outs of medicine, but youââ¬â¢ll still be an essential part of the medical office. If this sounds like the path for you, good luck!
Saturday, November 23, 2019
Tin Hedgehog Experiment - Grow Tin Metal Crystals
Tin Hedgehog Experiment - Grow Tin Metal Crystals Metal crystals are intricate and beautiful. They are also surprisingly easy to grow. In this experiment, learn how to grow tin crystals that display a spiky appearance that make them look like a metal hedgehog. Tin Hedgehog Materials 0.5 M tin(II) chloride solution (SnCl2)zinc pellettest tube or vial that is larger in diameter than the zinc The rounded hedgehog shape forms around a pellet of zinc, but you can substitute any chunk of zinc metal. Since the reaction occurs at the surface of the metal, you may also use a galvanized (zinc coated) object in place of the zinc pellet. Grow a Tin Hedgehog Pour tin chloride solution into a vial. Dont fill it up all the way because you need room for the zinc.Add the zinc pellet. Set the vial somewhere stable, so it wont get bumped or jarred.Watch the delicate tin crystals grow! Youll see the beginning of a spiky hedgehog shape in the first 15 minutes, with good crystal formation within an hour. Be sure to take pictures or video of the crystals for later, since the tin hedgehog wont last. Eventually, the weight of the fragile crystals or movement of the container will collapse the structure. The bright metallic shine of the crystals will dull over time, plus the solution will turn cloudy. Chemistry of the Reaction In this experiment, tin(II) chloride (SnCl2) reacts with zinc metal (Zn) to form tin metal (Sn) and zinc chloride (ZnCl2) via a substitution or single displacementà reaction: SnCl2à Zn ââ â Sn ZnCl2 Zinc acts as a reducing agent, giving electrons to the tin chloride so that the tin is free to precipitate.à The reaction begins at the surface of the zinc metal. As the tin metal is produced, atoms stack on top of each other in a characteristic form or allotrope of the element. The fern-like shape of the zinc crystals is a characteristic of that metal, so while other types of metal crystals may be grown using this technique, they wont display the same appearance. Grow a Tin Hedgehog Using an Iron Nail Another way to grow tin crystals is using zinc chloride solution and iron. Unless you use a round chunk of iron, you wont get a hedgehog, but you can get the crystal growth, just the same. Materials iron wire or nail0.1 M tin chloridetest tube Note: You dont need to make up a new tin chloride solution. If you have solution from the reaction with zinc, you can use that. The concentration mainly affects how quickly the crystals grow. Procedure Suspend the iron wire or nail in a test tube containing tin chloride.After about an hour, crystals will start to form. You can examine these with a magnifying glass or by removing the wire and looking at the crystals under a microscope.Allow the iron to remain in the solution overnight for more/larger crystals. Chemical Reaction Once again, this is aà simple displacement chemical reaction: Sn2à Fe ââ â Sn Fe2 Safety and Disposal As always, its good practice to wear safety goggles and gloves when performing chemistry experiments.When you have finished the experiment, you can rinse the chemicals down the drain with water. Learn More Use a magnifying lens to compare tin crystals grown on the zinc and iron surfaces.You may wish to experiment with how changing the concentration of the zinc chloride solution or temperature of the solution affects the crystal growth rate and appearance.Try to grow other metal crystals using this technique. Keep in mind the resulting crystals might not resemble a hedgehog. To choose a subject, find a metal salt that is soluble in water, does not oxidize too quickly in air, yet can react with zinc or iron (or other metal) to form crystals. The metal needs to be more reactive than tin or the substitution wont proceed.à Its also a good idea to consider the toxicity of the metal, for personal safety and chemical disposal. You can consult the solubility rules to select good candidates for further experimentation. Sources Holleman, Arnold F.; Wiberg, Egon; Wiberg, Nils (1985). Tin. Lehrbuch der Anorganischen Chemie (in German) (91ââ¬â100 ed.). Walter de Gruyter. pp. 793ââ¬â800. ISBN 3-11-007511-3.Schwartz, Mel (2002). Tin and Alloys, Properties. Encyclopedia of Materials, Parts and Finishes (2nd ed.). CRC Press. ISBN 1-56676-661-3.
Thursday, November 21, 2019
Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 words
Gene Prediction - Lab Report Example This corresponds to 331 codons also known as amino acids. The longest pattern always appears pink in color and the reading range was 1044 to 2039. The longest genome pattern highlighted pink was then clicked and BLAST button again clicked, the BLAST button appears at the top of the page. The BLAST button sets all the parameters as default. To check the highest bit score given by the human genome, view report button was clicked to display the results. In the results, the highest bit score realized was 675 consistent to the identities 331/331 (100%) with positives of 331/331 (100%). Gaps related to this experiment was 0/331 i.e. 0%. Still on the ORF Finder, when the button accept was clicked the longest ORF initially highlighted pink changed to green. 2 Fasta nucleotide was selected and view button clicked the sequence obtained is given below. Sequence 1 ORF: 1044 to 2039 Frame +3 ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA. Fasta formatted sequence was
Subscribe to:
Posts (Atom)